logo uach
logo Cori   
logo uach
COORDINACIÓN DE REVISTAS INSTITUCIONALES | UACh

e-ISSN: 2007-4034 / ISSN print: 1027-152X

Revista Chapingo Serie Horticultura

Creative Commons License

Vol. 26, issue 1 2020

ISSN:
ppub: 1027-152X epub: 2007-4034

Scientific article
doi: http://doi.org/10.5154/r.rchsh.2019.06.010

Selection of native yeasts for the production of sparkling ciders from apple varieties established in Querétaro, Mexico

León-Teutli, Alma Karina 1 ; Hernández-Iturriaga, Montserrat 1 ; Miranda-Castilleja, Dalia Elizabeth 1 ; Aldrete-Tapia, Jesús Alejandro 1 ; Soto-Muñoz, Lourdes 1 ; Martínez-Peniche, Ramón Álvar 1 *

  • 1Universidad Autónoma de Querétaro, División de Estudios de Posgrado, Facultad de Química. Centro Universitario s/n, col. Las Campanas, Querétaro, Querétaro, C. P. 76010, MÉXICO.

Corresponding author: alvar@uaq.mx, tel. 442 1 92 13 04.

Received: June 17, 2019; Accepted: November 02, 2019

License:

This is an open-access article distributed under the terms of the Creative Commons Attribution License view the permissions of this license

Abstract

The low quality of the apple produced in Querétaro, Mexico, impedes its efficient fresh marketing. One possible solution to this problem is to produce champagne-type sparkling cider. Therefore, the objective of this work was to select strains of Saccharomyces yeasts isolated from apple varieties of the region, based on desirable traits to make sparkling ciders. To select the yeasts, we induced the spontaneous fermentation of the must of 14 varieties, from which 135 strains (102 Saccharomyces spp.) were isolated and three (MM7, 436.4 and RY5) were selected, all with killer phenotype, β-glucosidase activity, tolerance to 8 % ethanol and 50 mg·L-1 of SO2, a different degree of flocculation and with the ability to produce more than 3 atm of pressure in the bottle. With MM7, a base cider of good quality was obtained (glucose < 2 g·L-1, pH 3.57, total titratable acidity of 4.03 g·L-1 and volatile acidity of 0.27 g·L-1). For the second fermentation, the base ciders made with MM7 were bottled, 15 g·L-1 of sucrose were added and then they were inoculated separately with MM7, 436.4, RY5 or K1-V1116. By day 21, they all reached about 6 atm of pressure. Sensorially, ciders made with MM7 stood out in effervescence speed, and those made with RY5 in taste acceptability. The amplification and sequencing of the ITS1/ITS4 domain identified MM7 and 436.4 as S. cerevisiae, and RY5 as S. paradoxus. The selected yeasts showed desirable traits for the production of quality sparkling ciders typical of the region.

Keywords Malus domestica Borkh; killer effect; β-glucosidase; Saccharomyces; champenoise method

Introduction

The main cider-producing states in Mexico are Puebla, Hidalgo and Chihuahua, and the main varieties used for its production are 'Golden Delicious', 'Red Delicious', 'Gala', 'Rome Beauty', 'Starking Delicious', 'Red Chief' and 'Top Red' (Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación [SAGARPA], 2017). For its part, the state of Querétaro has 422 ha established with apple trees (Servicio de Información Agroalimentaria y Pesquera [SIAP], 2017), where the main varieties are 'Golden Delicious' and 'Red Delicious'; however, the climate of this state and the poor application of cultivation techniques mean that most of the apple produced does not meet the desired physical traits, such as size, shape and absence of damage caused by pathogens or hail, making it difficult to market it fresh at profitable prices (Paz-Cuadra et al., 2014).

One possible solution to this problem is to produce derivatives, such as champagne-style sparkling cider (Nogueira & Wosiacki, 2012), which is obtained from a second fermentation inside the airtight bottle containing the base cider (the one resulting from the alcoholic fermentation of the apple must) (Herrero, Gonzalo, & García, 2010). At this stage of the process the pressure increases, which gives rise to the effervescence at the time of uncorking (Esteruelas et al., 2015). Effervescence is a quality parameter of ciders, and depends, to a large extent; on the strain of Saccharomyces spp. yeast used (Mangas, 2010).

The desirable traits of the yeasts to make sparkling cider are tolerance to sulfur dioxide and ethanol, β-glucosidase activity, killer effect (ability to produce a toxin that inhibits the growth of other microorganisms), tolerance to high CO2 pressures and flocculation capacity (Suárez-Valles, Pando-Bedriñana, Lastra-Queipo, & Mangas-Alonso, 2008). Therefore, Pando-Bedriñana, Querol-Simón, and Suárez-Valles (2010), when isolating yeasts during the fermentation of Asturian apple must (Spain), characterized their killer phenotype, β-glucosidase activity and production of hydrogen sulfide (H2S). Suárez-Valles et al. (2008) isolated Saccharomyces spp. yeasts for the production of sparkling cider by the champenoise method and determined their tolerance to ethanol, production of acetic acid and H2S, and their flocculant capacity.

In previous studies conducted in the region, the effect of commercial yeast and sugar level on the quality of sparkling cider was evaluated (Ramírez-Mora, Martínez-Peniche, & Fernández-Montes, 2005); however, the fermentation potential of the native yeast present in the apple has not been characterized so far. Therefore, the objective of the present study was to select strains of Saccharomyces yeasts isolated from various apple varieties in the region, based on desirable traits to make sparkling ciders. The hypothesis of this work is that in the Querétaro apple-producing region there are yeast strains with desirable genetic traits to make craft champagne-type ciders.

Materials and methods

Biological material and experimental site

We used apples (Malus domestica Borkh) of the varieties ‘Golden Delicious’, ‘Red Delicious’, ‘Joya’, ‘Rayada’, ‘Royal Gala’, ‘Agua Nueva’, ‘Rosada’, ‘424’, ‘428’, ‘429a’, ‘429b’, ‘436’, ‘467’ and ‘Malus x Micromalus’ established in a phenological orchard in San José Itho, Amealco, Querétaro, Mexico, located at 20° 11' N and 100° 08' W, at 2,275 masl. The orchard is rain-fed, with auxiliary irrigation during the dry spring period. The average annual temperature is 15.2 °C, with average annual rainfall of 927.7 mm (Servicio Meteorológico Nacional [SMN], 2016) and an average accumulation of chill hours of 500. The soil is deep (> 50 cm) and clayey, with pH 5.6, low salinity (0.03 dS·m-1) and low organic matter content (0.53 %).

The reference yeast strains of Saccharomyces cerevisiae were K1-V1116 (LALVIN®) and AH22 (sensitive to the killer genotype).

Yeast isolation

Apples were harvested according to their apparent maturity (visual appreciation of color) due to the scarcity of material; from these, the musts were obtained with a standard extractor (TU04, Turmix, Mexico). All musts were adjusted to 20 °Brix sucrose, sulphited (50 mg·L-1 of SO2), racked at 3 °C for 24 h and left to ferment spontaneously at 19 °C. Halfway through the fermentation (ρ = 1.03 g·mL-1) and at its end (ρ = 0.99 g·mL-1, or when the density remained constant), aliquots were taken, serial decimal dilutions were made, 100 μL were spread plated on nutrient yeast dextrose agar (NYDA) ‒supplemented with chloramphenicol (100 mg·L-1) and rose bengal (60 mg·L-1)‒ and incubated for two days at 28 °C.

From the plates corresponding to each apple variety, five colonies with contrasting morphologies were isolated at each stage of fermentation. The isolated strains were differentiated by three consecutive passes in lysine agar medium incubated at 25 °C for two days. Strains that did not grow in the medium were considered to be of the genus Saccharomyces (Medina et al., 2007).

Saccharomyces yeast selection tests

To determine killer effect, the methodology proposed by Lopes and Sangorrín (2010) was used, with some modifications. First, a total of 6 Log of CFU·mL-1 of the killer effect-sensitive strain (AH22) were poured plated in NYDA medium with methylene blue (0.2 %), NaCl (1 %) and phosphate citrate to adjust the pH to 4.6. Once the medium solidified, 5 μL of each strain were inoculated in drop form at a concentrationof 6 Log CFU·mL-1 and incubated for 72 h at 25 °C. The strains were considered killer when a blue-framed inhibition halo was observed around them.

β-glucosidase activity was determined in esculin glycerol agar medium at pH 6, for which each strain was separately streak plated, and incubated at 25 °C for two days. β-glucosidase activity was evidenced by the hydrolysis of the substrate, in which a brown precipitate forms around the colony (Pérez et al., 2011).

Flocculation capacity was determined as reported by Suárez-Valles et al. (2008), with some modifications. The strains were inoculated in 5 mL of NYDB broth and incubated at 25 °C for 72 h. Subsequently, the cultures were centrifuged and resuspended in 5 mL of Helm’s buffer solution (3 mmol·L-1 of CaCl2 and 50 mmol·L-1 of acetate-acetic buffer solution, pH 4.5). The flocculation index (FI) was determined by the ratio, in percent, of the optical density at 620 nm of the culture suspension and that obtained 120 min after adding Helm's solution. The strains were classified as: highly flocculant (FI < 30 %), moderately flocculant (FI between 30 and 70 %) and slightly flocculant (FI > 70 %).

For the fermentation rate, each strain was inoculated at a concentration of 6 Log CFU·mL-1 into tubes with 15 mL of sterile must adjusted to 25 °Brix and incubated at 25 °C for eight days. Weight loss per day was measured and a negative slope was obtained (g·day-1), in which three groups were formed according to their fermentation rate: slow (< -0.07 g·day-1), medium (between -0.071 and -0.08 g·day-1) and fast (> -0.081 g·day-1), preferring those cells that presented any of the last two.

Tolerance to ethanol and SO2 was determined by turbidimetry. First, 5 Log CFU of each strain were inoculated into individual microplate pits containing 200 μL of NYDB medium (pH = 3.8), with ethanol (8 %) and potassium metabisulfite (50 mg·L-1 of SO2) added. The microplates were incubated for 72 h at 25 °C and at the end the optical density was measured at 600 nm in a VariouskanTM analyzer (Thermo Fisher®, Finland). Strains with an OD600 > 0.7 were considered tolerant.

Pressure tolerance was evaluated from microfermentations. First, the base cider was obtained from pasteurized must and adjusted to 25 °Brix, for which the commercial yeast K1-V1116 was used. At the end of the first fermentation, 300 mL of base cider were emptied into disinfected PET bottles fitted with a Schrader valve; 30 g·L-1 of sugar and 6 Log UFC·mL-1 of the native yeast to be evaluated were added. Finally, the pressure was measured weekly for 49 days with a pneumatic manometer (Autotec 77992, AutoZone, Mexico).

Production of sparkling cider

‘Golden Delicious’ apple must was sulphited, racked and inoculated (1x105 CFU·mL-1) with the most outstanding native strain to obtain the base cider. The juice was fermented at 19 ± 1 °C, as proposed by Soto-Herrera, Castillo-Castañeda, and Martínez-Peniche (2008). The cider obtained was decanted, clarified with albumin and divided into batches corresponding to the pre-selected strains to be evaluated. In each batch, tirage liquor (1x105 CFU·mL-1 of the yeast strain and 30 g·L-1 of sucrose) and 50 mg·L-1 of ammonium sulfate were added, and it was distributed in six 250 mL PET bottles fitted with a Schrader valve. The bottles were left to ferment at 16 ± 1 °C for 28 days. The internal pressure was measured weekly with the manometer.

At the end of the second fermentation, the sediments were removed by inverting the bottles (25 days), freezing the bottle neck and then disgorging. Finally, following the protocols recognized by the International Organisation of Vine and Wine (OIV, 2017), the following were determined: alcohol by volume (ABV) by distillation and densimetry, residual sugars (RS; g·L-1) by Fheling-Causse-Bonnans, pH by means of a potentiometer, total titratable acidity (TTA; g·L-1) by titration, volatile acidity (VA; g·L-1) with the García-Tena methodology and total sulphurous anhydride (SO2) by iodimetry (mg·L-1).

Sensory analysis

Two unstructured linear hedonic tests were carried out with limits from 0 to 10 (where 0 corresponds to “I really dislike it” and 10 to “I like it a lot”) and 10 semi-trained panelists. In the first test the foaming characteristics of the ciders were evaluated: a) crown height (foam formed on the liquid surface), b) crown reduction time, c) number of trains (corresponding to the bubble lines that form within the liquid and rise to the surface), d) bubble diameter and e) effervescence speed. The second test assessed the acceptability of appearance, aroma and taste (Soto-Herrera et al., 2008).

Identification of selected yeasts

Species-level identification of the selected yeasts was performed by amplification through polymerase chain reaction (PCR) and subsequent sequencing of the ITS1/ITS4 region with the oligonucleotides ITS1 (5’ TCCGTAGGTGAACCTGCGG 3’) and ITS4 (5’ TCCTCCGCTTATTGATATGC 3’), using the following conditions: 2 min at 95 °C, 35 cycles (30 s at 95 °C, 1 min at 56.75 °C and 1 min at 72 °C) and 10 min at 72 °C. The amplicons were sent to LANBAMA of the Instituto Potosino de Investigación Científica y Tecnológica (IPICYT, SLP) for purification and subsequent sequencing with Sanger’s technique and a genetic analyzer (3130 Genetic analyzer, Thermo Fisher®, USA). The sequences obtained were compared with those of GenBank using the Blast program.

Statistical analysis

A completely randomized unifactorial experimental design with a different number of replicates was used, with the yeast strains being the study factor. All yeast preselection determinations were performed in triplicate. The data of the quantitative variables were subjected to an analysis of variance and Tukey’s test (P ≤ 0.05), for which the JMP version 11 statistical program was used. To determine differences between the sensory characteristics of the ciders, the Friedman test was used with the Prism-GraphPad program.

Results and discussion

Initial must characteristics

Table 1 shows the initial characteristics of each apple variety used, and it can be seen that there are important differences among them. The highest must yields were obtained with ‘429a’, ‘428, ‘Red Delicious’ and ‘Rayada’ (0.45, 0.45, 0.44 and 0.43 L·kg-1 of apple, respectively), which contrast with ‘Malus x Micromalus’ (02.26 L·kg-1 of apple); this is probably due to the low percentage of juice and greater firmness of the ‘Malus x Micromalus’ pulp. The highest concentration of sugars was in ‘Agua Nueva’ and ‘Royal Gala’ (17 °Brix), which differs from that obtained with ‘424’ and ‘Rayada’ (11.2 and 11.4 °Brix, respectively). Finally, the highest pH value was recorded by the must obtained with ‘428’ (pH = 4.37), and the lowest value was shown by ‘Malus x Micromalus’ (pH = 2.97).

Table 1. Initial must characteristics of different apple varieties.

Apple variety Yield (L·kg-1 of apple) Sugars (°Brix) Density (g·mL-1) pH
429a 0.45 12.2 1.049 3.27
Rayada 0.43 11.4 1.043 3.21
Red Delicious 0.44 11.6 1.043 3.64
428 0.45 12.8 1.047 4.37
424 0.33 11.2 1.044 3.51
Malus x Micromalus 0.26 15.0 1.058 2.97
467 0.30 12.0 1.043 3.32
Joya 0.31 12.0 1.044 4.10
429b 0.29 12.0 1.047 3.31
Golden Delicious 0.30 15.4 1.062 3.36
Agua Nueva 0.40 17.0 1.066 3.32
436 0.31 14.2 1.054 4.45
Royal Gala 0.29 17.0 1.069 3.26
Rosada 0.36 14.4 1.060 3.46

Yeast isolation and differentiation

The evolution of spontaneous fermentations, measured by density, was very variable (Figure 1). Variety ‘436’ completed fermentation in five days, while ‘467’ and ‘Golden Delicious’ did so in 24 days. For their part, ‘Malus x Micromalus’, ‘Rayada’, ‘429b’ and ‘Joya’ did not finish the fermentation process. Many factors are involved in the development of fermentation, including the concentration of nutrients, the way in which the added sulphurous anhydride is combined, and the type of microorganisms present in the apple must, as they can compete with the fermentative yeasts for space and nutrients, or produce protein-type compounds (killer effect) or short- or medium-chain fatty acids that inhibit fermentation (Irastorza & Dueñas, 2010). Rapid fermentation is generally preferred, as otherwise there is a risk of microbiological contamination and increased production costs.

Figure 1. Evolution of the must density of 14 apple varieties.

From the spontaneous fermentations produced with the 14 varieties, 135 yeasts were isolated, as it was not possible to recover viable yeasts from variety ‘429’ at the end of fermentation. This is probably because none of the yeasts were able to tolerate the inhibitory conditions generated during the fermentation of this variety. Of the 135 isolated yeasts, 102 (75.5 %) corresponded to the genus Saccharomyces, which coincides with the findings reported by Suárez-Valles et al. (2008), who obtained 70 % Saccharomyces spp. yeasts in isolations carried out at different stages of cider fermentation.

Characterization and selection of yeast strains

Two factors were considered in the selection of Saccharomyces spp. yeasts: β-glucosidase acitivity and the presence of the killer phenotype. Of the initial 102 strains, 60 (58.8 %) had β-glucosidase activity, which contrasts with Pando-Bedriñana et al. (2010) , who found only 2 of 134 strains. The divergence of the results may be due to the fact that in this study the yeasts were isolated from 14 varieties, separately, while in the reported work the isolates were made in Asturian cider cellars, frequently prepared with mixtures (Boletín Oficial de Estado [BOE], 2003). A greater number of varieties obtained from the field increases the possibilities of obtaining phenotypic diversity from isolated microorganisms.

Glucosylated terpenes present in apples can be hydrolyzed by β-glucosidase, which releases volatile compounds that enhance the aroma and reveal typical varietal characteristics (Carrau, Dellacassa, & Boido, 2008). However, the presence of the enzyme does not ensure its action in the fermentation medium, because it is associated with the yeast cell wall, which makes it susceptible to inhibition by ethanol (Mateo & Maicas, 2016).

On the other hand, of the total initial strains, only 18 (17.5 %) presented killer effect. These results contrast with what was reported by Pando-Bedriñana et al. (2010), who observed that of 134 strains isolated from cider, only two (1.9 %) exhibited this effect. These differences may be due to the origin of the yeasts. In the field, yeasts compete with a greater diversity of microorganisms, so they must develop mechanisms, such as the killer phenotype, to survive; in wineries, on the other hand, yeasts are adapted to the limiting conditions of the environment, which favor not requiring certain antagonistic mechanisms.

The secretion of toxins that inhibit the development of susceptible microorganisms acts as a mechanism for regulating population dynamics in microbial ecosystems and is considered a favorable factor for the selection of fermentative microorganisms, since they provide a competitive advantage. The susceptibility to these toxins is regulated by receptors in the cell wall of the sensitive microorganism (García, Esteve-Zarzozo, & Arroyo, 2016).

In total, 66 strains showed one or two characteristics indicated above, so for the rest of the tests only these were considered (Table 2).

Table 2. Phenotypic characterization for the selection of cider fermenting yeasts.

Apple variety Strain Positive aspects β-glucosidase Killer effect Flocculation Fermentation rate Tolerance to ethanol and SO2 Fermentation stage
- k1 5 + + Medium Medium + -
Malus x Micromalus MM7 5 + + Medium Medium + Final
Royal Gala RG6 5 + + Medium Fast + Final
436 436.4 5 + + Medium Fast + Intermediate
Red Delicious RD4 4 + + Medium Medium - Intermediate
428 428.5 4 + + Medium Medium - Intermediate
Agua Nueva AN7 4 + - High Fast + Final
Rayada RY3 4 + - Medium Fast + Intermediate
Royal Gala RG4 4 + - Medium Fast + Intermediate
428 428.6 4 + - Medium Medium + Final
429a 429a.9 4 + - Medium Fast + Final
436 436.5 4 - + Medium Medium + Intermediate
467 461.1 4 + - Medium Fast + Intermediate
467 467.2 3 + + Slight Medium - Intermediate
467 467.4 3 + + Slight Medium - Intermediate
467 467.5 3 + + Slight Medium - Intermediate
Red Delicious RD3 3 + + Slight Fast - Intermediate
428 428.3 3 + + Slight Medium - Intermediate
Red Delicious RD2 3 + - Medium Fast - Intermediate
Agua Nueva AN5 3 + - Medium Medium - Intermediate
Agua Nueva AN10 3 + - High Fast - Final
Agua Nueva AN8 3 + - High Fast - Final
Joya JY4 3 + - Medium Slow + Intermediate
Royal Gala RG7 3 + - Medium Fast - Final
Royal Gala RG8 3 + - Medium Fast - Final
424 424.4 3 + - Medium Fast - Intermediate
428 428.4 3 + - Medium Medium - Intermediate
428 428.8 3 + - Medium Fast - Final
429a 429.10 3 + - Medium Fast - Final
436 436.3 3 + - High Fast - Intermediate
436 436.9 3 + - Medium Medium - Final
436 436.10 3 + - Medium Medium - Final
Rayada RY5 3 - + Slight Medium + Intermediate
Rayada RY9 3 - + Slight Fast + Final
Rayada RY10 3 - + Slight Medium + Final
Royal Gala RG10 2 + - Slight Fast - Final
436 436.2 2 + - Slight Fast - Intermediate
Royal Gala RG3 2 - + Slight Slow - Intermediate
424 424.5 2 + + Slight Slow - Intermediate
428 428.2 2 + + Slight Slow - Intermediate
Joya JY1 2 + + Slight Slow - Intermediate
428 428.1 2 + - Medium Slow - Intermediate
436 436.1 2 + - Medium Slow - Intermediate
436 436.2 2 + - Medium Slow - Intermediate
436 436.7 2 + - Medium Slow - Final
Golden Delicious GD10 1 + - Slight Slow NE1 Final
Red Delicious RD7 1 + - Slight Slow NE Final
Agua Nueva AN1 1 + - Slight Slow NE Intermediate
Agua Nueva AN2 1 + - Slight Slow NE Intermediate
Agua Nueva AN3 1 + - Slight Slow NE Intermediate
Agua Nueva AN4 1 + - Slight Slow NE Intermediate
Agua Nueva AN6 1 + - Slight Slow NE Final
Joya JY6 1 + - Slight Slow NE Final
Joya JY8 1 + - Slight Slow NE Final
Malus x Micromalus MM4 1 + - Slight Slow NE Intermediate
Malus x Micromalus MM8 1 + - Slight Slow NE Final
Rayada RY1 1 + - Slight Slow NE Intermediate
424 424.3 1 + - Slight Slow NE Intermediate
424 424.7 1 + - Slight Slow NE Final
424 424.9 1 + - Slight Slow NE Final
428 428.7 1 + - Slight Slow NE Final
436 436.6 1 + - Slight Slow NE Final
467 467.3 1 + - Slight Slow NE Intermediate
467 467.6 1 + - Slight Slow NE Final
467 467.7 1 + - Slight Slow NE Final
467 467.8 1 + - Slight Slow NE Final
Strains are ordered from highest to lowest number of characteristics presented considered to be positive. The symbols indicate presence (+) or absence (-) of the aspect evaluated in each strain. 1NE = phenotype not evaluated due to lack of other desirable traits.

Regarding flocculant capacity, 30 of the 66 yeasts evaluated were moderately or highly flocculant according to the scale proposed by Suárez-Valles et al. (2008). This characteristic is essential for yeasts, mainly in the second fermentation by the champenoise method, since to eliminate the lees in the disgorging process it is required that the yeast has the capacity to generate flocs and precipitate without adding any clarifier (Garofalo et al., 2016).

In terms of fermentation rate, 38 strains showed medium or high values, which depends on the ability of each yeast to respond to stress conditions: nutrient content of the must, temperature, ethanol or fatty acid toxicity, and proportion of nitrogen sources, among others (Irastorza & Dueñas, 2010; Varela, Pizarro, & Agosin, 2004). For selection purposes, if fermentation is slow, there is a risk of contamination and production costs increase as fermentation tanks are used longer; however, if it is very fast, the temperature tends to increase, which causes fermentation to stop and there is a loss of aromatic compounds. High temperature and fast fermentation are considered controllable by cooling systems, so medium to high speeds are recommended (Bisson & Batszuke, 2000).

To assess the tolerance of the strains to ethanol and SO2, only the 45 strains (including K1-V1116) that had at least two of the four previously evaluated traits (killer effect, β-glucosidase, flocculation and fermentation rate) were considered. The presence of turbidity in the medium containing 8 % ethanol and 50 mg·L-1 of SO2, after a 48 h incubation, indicated yeast growth and, therefore, tolerance to these two compounds; 15 strains with this trait stood out in the test (Table 2).

Ethanol is one of the most inhibitory compounds formed during fermentation, as it affects plasma membrane fluidity, vacuole morphology, glycolytic enzyme activity and mitochondrial DNA (Miranda et al., 2017). Mukherjee et al. (2014) report that some yeast strains may grow or survive in the presence of ethanol due to certain alleles that counteract the toxic effects of this compound. Likewise, sterols and unsaturated fatty acids synthesized in the presence of oxygen, such as palmitoleic acid (D9-cisC16:1) and oleic acid (D9-cisC18:1), play a fundamental role in ethanol tolerance (García, Quintero, & López-Munguía, 2004). In addition, it is important that the selected yeasts tolerate high concentrations of SO2, as this will allow them to survive being sulphited, which will help them to impose themselves on wild yeasts (Ubeda, Briones, Izquierdo, & Palop, 1995). The test carried out (combining two inhibitors) is more demanding and more representative than the condition presented in the fermentation medium, where various factors that limit the development of microorganisms interact.

Of the 66 yeasts evaluated, four (including reference K1-V1116) showed the five desirable traits, while 34 (51 %) presented at least three of these traits (Table 2). Of the latter, 19 (56 %) were isolated halfway through fermentation and 15 (44 %) at the end of the process, a stage in which yeasts with the best fermentative characteristics were expected to predominate, as they would be adapted to the medium and would tolerate the most inhibitory conditions present in advanced stages of fermentation (Steensels & Verstrepen, 2014).

Regarding apple varieties, those with the highest number of strains with at least two desirable traits were ‘436’ (rapid fermentation), ‘428’ and ‘Royal Gala’ (with eight, seven and six strains, respectively), and with ‘467’, ‘Agua Nueva’ and ‘Rayada’ four strains were found. The varieties that contributed strains with three or fewer desirable traits were ‘Red Delicious’, ‘424’, ‘429b’, ‘Joya’, ‘Malus x Micromalus’ and ‘Golden Delicious’. In general, the varieties where fermentation was not completed, or where it took longer, were those with the fewest number of strains with positive traits; however, strain MM7, from incomplete fermentation, manifested the five desirable traits evaluated.

Considering the above results, ten strains were selected for the following tests: three that presented the five traits evaluated (MM7, 436.4 and RG6), three with four traits (AN5, RG8 and 429a.9) and four with three traits (428.3, RY3, RY5 and 428.6). In this way, different varieties and different combinations of aspects of interest were covered.

Pressure tolerance

Figure 2 shows a similar behavior in the evolution of the pressure in the bottle generated by the different yeast strains throughout the process, with the exception of strain 428.6, which generated a lower pressure than the rest of the yeasts. After 49 days, there were differences among the yeasts, especially MM7, a strain similar to the commercial control K1-V1116 and contrasting with 428.6.

Figure 2. Pressure generated by ten strains of native yeasts and commercial control K1-V1116 inside bottles. zMeans with the same letter do not differ statistically (Tukey, P ≤ 0.05).

The carbon dioxide in the medium is inhibitory to yeasts, as it can slightly lower the pH, although, fundamentally, it increases atmospheric pressure, which limits the development of microorganisms. Yeasts tolerate around 7 atm (maximum reached in sparkling wines), as a higher pressure inhibits their metabolism and slows their development (Borrull, Poblet, & Rozès, 2015). Like many types of stress, pressure decreases the cell cycle and reduces the viability of microorganisms as it increases; above 30 atm it generates inhibition and when it is greater than 500 atm it alters the morphology of microorganisms. Additionally, it is known that, like other stressors, pressure can generate cross-tolerance; that is, barotolerance can be acquired by sublethal pretreatment with other stressors such as temperature, ethanol or the same pressure (Fernandes, 2005).

Behavior of selected native yeasts in the production of sparkling cider

Considering the above tests, strain MM7 was selected for the first fermentation, as it presented the killer effect, β-glucosidase activity and average fermentation speed. For the second fermentation, MM7 and 436.4 were chosen, as they presented the five desirable traits, and RY5 which presented three of these traits, including killer effect, average fermentation speed and tolerance to ethanol and SO2; in addition, these three strains were the most pressure tolerant. Also, commercial yeast K1-V1116 was included.

The first fermentation took place normally, reaching a constant density by the sixth day, which indicated its end. The evolution of the second fermentation, measured by the pressure increase in the bottle, is shown in Figure 3 where it can be observed that by day seven the reference yeast K1-V1116 already had a pressure of 5.10 atm, followed by 436.4 (4.39 atm), MM7 (3.25 atm) and RY5 (2.91). Day 21 was considered the end of the second fermentation, at which time K1-V1116, 436.4 and MM7 reached a similar pressure (5.93, 5.83 and 5.75 atm, respectively), being higher than RY5 (5.49 atm).

Figure 3. Evolution of the pressure in the bottle as a function of the yeast used for the second fermentation of base cider. Means of six observations ± standard error.

During the second fermentation, the CO2 produced raises the internal pressure of the bottle and generates effervescence at the time of serving (Liger-Belair et al., 2009). It is considered that 5 g·L-1 of sugar increases the pressure by approximately 1 atm (Navarre, 1998), which coincides with this study, because with 30 g·L-1 of sugar, about 6 atm of pressure were obtained with the four strains evaluated. Yeast RY5 was the least efficient in this respect, which coincides with the fact that it was the least outstanding of the three in the other selection criteria.

With respect to the physical and chemical analysis of the ciders (Table 3), the three strains selected obtained values similar to those of the commercial strain. The ABV fluctuated between 8.13 and 8.89, being higher with strain RY5. The RS ranged from 1.65 to 1.96 g·L-1, which corresponds to complete fermentations. The VA ranged from 0.04 to 0.48 g·L-1, obtaining the highest concentration with RYS; pH, from 3.61 to 3.66; TTA, from 4.05 to 4.28 g·L-1, and SO2, from 202 to 226 mg·L-1, values that are within the standards established by the Mexican official standard for alcoholic beverages (NOM-199-SCFI-2017, 2017).

Table 3. Physical and chemical characteristics of sparkling ciders as a function of the yeast used in the second fermentation.

Treatment1 ABV RS (g·L-1) TTA (g·L-1) pH VA (g·L-1) SO2 (mg·L-1)
MM7-K1-V1116 8.57 ± 0.05 bz 1.65 ± 0.01 c 4.28 ± 0.03 a 3.66 ± 0.01 a 0.05 ± 0.03 b 226.13 ± 9.4 a
MM7-MM7 8.59 ± 0.05 b 1.96 ± 0.03 a 4.05 ± 0.03 c 3.64 ± 0.03 ab 0.07 ± 0.03 b 221.87 ± 0.9 a
MM7-436.4 8.13 ± 0.08 c 1.78 ± 0.01 b 4.21 ± 0.03 b 3.61 ± 0.02 b 0.04 ± 0.03 b 202.99 ± 13 a
MM7-RY5 8.89 ± 0.05 a 1.80 ± 0.03 b 4.21 ± 0.03 b 3.61 ± 0.01 ab 0.48 ± 0.03 a 205.3 ± 12 a
1Yeast strain used for the first fermentation + strain used for the second fermentation; ABV = alcohol by volume; RS: residual sugars; TTA: total titratable acidity; VA = volatile acidity. zMeans with the same letter within each column do not differ statistically (Tukey, P ≤ 0.05).

Sensory analysis

The Friedman test showed significant differences (P ≤ 0.05) in all sensory variables evaluated (Table 4). At crown height, cider made with 436.4 obtained the highest value in the rank sum (RS = 34.5), corresponding to a greater preference. According to Esteruelas et al. (2015), ciders are expected to have a higher crown height at the time of serving. K1-V1116 achieved the highest values for crown reduction time (RS = 40.0), number of trains (RS = 38.5) and bubble diameter (RS = 37.5); the highest values in this last variable indicate smaller bubbles. Finally, with strains MM7 and 436.4, the highest effervescence speed values were obtained (higher speed in the ascent of the bubbles to the liquid surface) (RS = 36.0 and 34.0, respectively).

Table 4. Rank sum of the Friedman test to sensorially evaluate the quality of sparkling ciders made with four yeast strains.

Trait evaluated K1-V1116 436.4 MM7 RY5 F P
Crown height 22.51 34.5 24.5 18.5 9.58 0.0224
Crown reduction time 40.0 30.0 20.0 10.0 30.00 < 0.0001
Number of trains 38.5 10.0 31.5 20.0 29.35 < 0.0001
Bubble diameter 37.5 19.0 32.5 11.0 26.94 < 0.0001
Effervescence speed 20.0 34.0 36.0 10.0 27.12 < 0.0001
Visual 33.5 18.0 35.5 13.0 22.76 < 0.0001
Olfactory 40.0 30.0 20.0 10.0 30.00 < 0.0001
Taste 29.0 21.0 10.0 40.0 28.92 < 0.0001
1The treatment averages come from ten replicates (judges).

Effervescence is a key attribute in sparkling beverages, as it is the first thing consumers perceive (Brissonnet & Maujean, 1993; González, 2010). The yeast used in the second fermentation of sparkling cider affects its composition, mainly due to the speed of autolysis that allows the release of polysaccharides, proteins, peptides, free amino acids, lipids and nucleotides into the medium (Alexandre & Guilloux-Benatier, 2008; Comuzzo et al., 2015), which provides the cider with foam stability, decreased astringency, protection against oxidation, and greater aromatic and flavor complexity (Pozo-Bayón, Andujar-Ortiz, Alcaide-Hidalgo, Martín-Álvarez, & Moreno-Arribas, 2009).

In terms of visual preference, ciders made with K1-V1116 and MM7 (RS = 35.5 and 33.5, respectively) stood out, which coincides with the results obtained in the sensory evaluation of the effervescence produced. In the olfactory aspect, the commercial strain K1-V1116 (RS = 40.0) stood out, which agrees with its technical fact sheet in which it is recognized as an ester-producing yeast that releases floral and fruity aromas (LALVIN, 2014). On the other hand, with strain RY5 a very low value was obtained (RS = 10.0) in this aspect; however, this strain reached the highest preference at taste level (RS = 40.0), being above the control. This contrasts sharply with the values obtained in the rest of the variables, both sensory and analytical. In general terms, MM7 stood out among the native strains, contrasting strongly with RY5.

The results obtained show that native strains can produce sparkling ciders of quality and acceptability comparable to those produced with commercial strains. The economic benefits of having a yeast strain that produces a sparkling cider that stands out in its characteristics are that it can be recognized by the knowledgeable consumer and, therefore, can generate greater prestige and profit, as is the case with champagne.

Molecular identification of yeasts

The homologies with the database showed, with sufficient confidence (E-Values of 0 & Query Cover of 99 %), that strain RY5 belongs to Saccharomyces paradoxus (100 % ID), while MM7 and 436.4 belong to S. cerevisiae (99 and 87 % ID, respectively). Strain RY5, with the least outstanding traits, belongs to a species little related to fermentative environments; instead, its presence has been detected in the field (Kowallik, Miller, & Greig, 2015). However, this strain had outstanding taste acceptance and high alcohol production, which has not been reported for cider production, so it should be further studied.

Conclusions

The greatest number of strains with desirable traits is obtained halfway through fermentation. Some of the isolated strains, such as MM7 and 436.4, had similar behavior to that of the control strain (K1-V1116), showing desirable characteristics for the production of sparkling ciders.

The PCR amplification technique of the ITS1/ITS4 domain and its sequencing allowed the identification of the three selected strains. Most of the yeasts isolated from spontaneous fermentations of different apple varieties in the region belong to the genus Saccharomyces. Strain RY5 (S. paradoxus) stood out for its taste acceptability and its high efficiency in the conversion of sugar into alcohol, characteristics not previously reported, which merits further study.

Acknowledgments

  • The authors thank the National Council of Science and Technology (CONACyT) for its financial support, and the apple producers of San José Itho, Amealco, Querétaro, for the assistance provided for conducting this research.

References

Alexandre, H., & Guilloux-Benatier, M. (2008). Yeast autolysis in sparkling wine-a review. Australian Journal of Grape and Wine Research, 12(2), 119-127. doi: 10.11117j.1755-0238.2006.tb00051.x

Bisson, L. F., & Butzke, C. E. (2000). Diagnosis and rectification of stuck and sluggish fermentations. American Journal of Enology and Viticulture, 51(2), 168-177. Retrieved from https://www.ajevonline.org/content/51/2/168

Boletín Oficial de Estado (BOE). (2003). Consejo regulador sidra de Asturias. Retrieved from http://sidradeasturias.es/archivos/enlaces_1266846536.pdf

Borrull, A., Poblet, M., & Rozès, N. (2015). New insights into the capacity of commercial wine yeasts to grow on sparkling wine media. Factor screening for improving wine yeast selection. Food Microbiology, 48, 41-48. doi: 10.1016/j.fm.2014.12.006

Brissonnet, F., & Maujean, A. (1993). Characterization of foaming proteins in a champagne base wine. American Journal of Enology and Viticulture, 44(3), 297-301. Retrieved from https://www.ajevonline.org/content/44/3/297

Carrau, F., Dellacassa, E., & Boido, E. (2008). Terpenoids in grapes and wines: origin and micrometabolism during the vinification process. Natural Product Communications, 3(4), 577-592. doi: 10.1177/1934578X0800300419

Comuzzo, P., Battistutta, F., Vendrame, M., Páez, M. S., Luisi, G., & Zironi, R. (2015). Antioxidant properties of different products and additives in white wine. Food Chemistry, 168, 107-114. doi: 10.1016/j.foodchem.2014.07.028

Esteruelas, M., González-Royo, E., Gil, M., Kountoudakis, N., Orte, A., Cantos, A, Fort, F., Canals, J. M., & Zamora, F. (2015). Influence of temperature during the second fermentation and aging of sparkling wine (Cava) on the properties of the foam. BIO Web Conferences, 5, 02011. doi: 10.1051/bioconf/20150502011

Fernandes, P. M. B. (2005). How does yeast respond to pressure?. Brazilian Journal of Medical and Biological Research, 38(8), 1239-1245. doi: 10.1590/S0100-879X2005000800012

García, M., Quintero, R., & López-Munguía, A. (2004). Biotecnología alimentaria. Ciudad de México, México: Limusa.

García, M., Esteve-Zarzozo, B., & Arroyo, T. (2016). Non-Saccharomyces yeasts: biotechnological role for wine production. In: Morata, A., & Loira, I. (Eds.), Grape and wine biotechnology (pp. 261). Zagreb, Croatia: IntechOpen. doi: 10.5772/64957

Garofalo, C., Arena, M. P., Laddomada, B., Cappello, M. S., Bleve, G., Grieco, F., Beneduce, L., Berbegal, C., Spano, G., & Capozzi, V. (2016). Starter cultures for sparkling wines. Fermentation, 2(21), 1-16. doi: 10.3390/fermentation2040021

González, M. (2010). La evaluación sensorial. In: Blanco, D., & Mangas, J. (Eds.), La manzana y la sidra: bioprocesos, tecnologías de elaboración y control (pp. 139). Asturias, España: Asturgraf.

Herrero, M., Gonzalo, Á., & García, L. (2010). Tecnología de la producción de sidra. Equipamiento industrial. In: Blanco, D., & Mangas, J. (Eds.), La manzana y la sidra: bioprocesos, tecnologías de elaboración y control (pp. 198-207). Asturias, España: Asturgraf

Irastorza, A., & Dueñas, M. (2010). Microbiología de la sidra. In: Blanco, D., & Mangas, J. (Eds.), La manzana y la sidra: bioprocesos, tecnologías de elaboración y control (pp. 105-120). Asturias, España: Asturgraf .

Kowallik, V., Miller, E., & Greig, D. (2015). The interaction of Saccharomyces paradoxus with its natural competitors on oak bark. Molecular Ecology, 24(7), 1596-1610. doi: 10.1111/mec.13120

LALVIN (2014). Lalvin V1116: Fresh fruit white wines. Retrieved from https://www.lallemandbrewing.com/docs/products/tds/TDS_LALVIN_V1116_ENG_DIGITAL.pdf

Liger-Belair, G., Cilindre, C., Gougeon, R. D., Lucio, M., Gebefügi, I., Jeandet, P., & Schmitt-Kopplin, P. (2009). Unraveling different chemical fingerprints between a champagne wine and its aerosols. Proceedings of the National Academy of Sciences, 106(39), 16545-16549. doi: 10.1073/pnas.0906483106

Lopes, C. A., & Sangorrín, M. P. (2010). Optimization of killer assays for yeast selection protocols. Revista Argentina de Microbiología, 42(4), 298-306. doi: 10.1590/S0325-75412010000400011

Mangas, J. (2010). Sidras espumosas. In: Blanco, D., & Mangas, J. (Eds.), La manzana y la sidra: bioprocesos, tecnologías de elaboración y control (pp. 224). Asturias, España: Asturgraf .

Mateo, J., & Maicas, S. (2016). Application of non-Saccharomyces yeasts to wine-making process. Fermentation, 2(3), 1-13. doi: 10.3390/fermentation2030014

Medina, K., Ferreri, L., Fariña, L., Boido, E., Dellacassa, E., Gaggero, C., & Carrau, F. (2007). Aplicación de la levadura Hanseniaspora vineae en cultivos mixtos con Saccharomyces cerevisiae en la vinificación. Enología, 4(6), 1-6. Retrieved from http://riquim.fq.edu.uy/archive/files/c59d9a5a4792851512e4821636c4e9e8.pdf

Miranda, D., Aldrete, J., Arvizu, S., Hernández, M., Soto, L., & Martínez, R. (2017). Growth kinetics for the selection of yeast strains for fermented beverages. In: Morata, A., & Loira, I. (Eds.), Yeast - Industrial applications (pp. 74-75). Sarajevo, Croitia: InTech. doi: 10.5772/intechopen.70224

Mukherjee, V., Steensels, J., Lievens, B., Van de Voorde, I., Verplaetse, A., Aerts, G., Willems, K., Thevelein, J., Verstrepen, K., & Ruyters, S. (2014). Phenotypic evaluation of natural and industrial Saccharomyces yeasts for different traits desirable in industrial bioethanol production. Applied Microbiology of Biotechnology, 98(22), 9483-9498. doi: 10.1007/s00253-014-6090-z

Navarre, J. (1998). Manuel d´Œnologie. Paris, France: Bailliere.

Nogueira, A., & Wosiacki, G. (2012). Apple cider fermentation. In: Hui, Y., & Özgül, E. (Eds.), Handbook of plant-based fermented food and beverage technology (pp. 209-235). Boca Ratón, USA: CRC Press.

Norma Oficial Mexicana (NOM-199-SCFI-2017). (2017). Bebidas alcohólicas - Denominación, especificaciones fisicoquímicas, información comercial y métodos de prueba. Retrieved from http://www.dof.gob.mx/nota_detalle.php?codigo=5502882&fecha=30/10/2017

Organización Internacional de la Viña y el Vino (OIV). (2018). Compendio de los métodos internacionales de análisis de los vinos y de los mostos. París, Francia: Author.

Pando-Bedriñana, R., Querol-Simón, A., & Suárez-Valles, B. (2010). Genetic and phenotypic diversity of autochthonous cider yeasts in a cellar from Asturias. Food Microbiology , 27(4), 503-508. doi: 10.1016/j.fm.2009.11.018

Paz-Cuadra, A., Guzmán-Pantoja, L., Martínez-Peniche, R., Caltzontzin-Fernández, K., Pacheco-Aguilar, J., & Arvizu-Medrano, S. (2014). Evaluation of the susceptibility of apple genotypes in Queretaro, Mexico to powdery mildew (Podosphaera leucotricha). Scientia Horticulturae, 170, 53-60. doi: 10.1016/j.scienta.2014.01.044

Pérez, G., Fariña, L., Barquet, M., Boido, E., Gaggero, C., Dellacassa, E., & Carrau, F. (2011). A quick screening method to identify β-glucosidase activity in native wine yeast strains: application of Esculin Glycerol Agar (EGA) medium. World Journal of Microbiology and Biotechnology, 27(1), 47-55. doi: 10.1007/s11274-010-0425-4

Pozo-Bayón, M. A., Andujar-Ortiz, I., Alcaide-Hidalgo, J., Martín-Álvarez, P., & Moreno-Arribas, M. (2009). Characterization of commercial inactive dry yeast preparations for enological use based on their ability to release soluble compounds and their behavior toward aroma compounds in model wines. Journal of Agricultural Food Chemistry, 57(22), 10784-10792. doi: 10.10217jf900904x

Ramírez-Mora, E., Martínez-Peniche, R., & Fernández-Montes, M. (2005). Efecto de la concentración de azúcar y la cepa de levadura en la calidad de sidra espumosa. Brazilian Journal of Food Technology, 5, 89-95. Retrieved from https://docplayer.es/14988843-Efecto-de-la-concentracion-de-azucar-y-la-cepa-de-levadura-en-la-calidad-de-sidra-espumosa.html

Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación (SAGARPA). (2017). Un buen vino o una buena sidra para despedir el año. Ciudad de México, México: Author. Retrieved from https://www.gob.mx/agricultura/es/articulos/un-buen-vino-o-una-buena-sidra-para-despedir-el-ano

Servicio de Información Agroalimentaria y Pesquera (SIAP). (2017). Avance de siembras y cosechas. Resumen nacional por cultivo. Ciudad de México: Author. Retrieved from http://infosiap.siap.gob.mx

Servicio Meteorológico Naciona (SMN) (2016). Información climatológica por estado. Ciudad de México: Author . Retrieved from http://smn.cna.gob.mx/es/informacion-climatologica-ver-estado?estado=qro

Soto-Herrera, J., Castillo-Castañeda, E., & Martínez-Peniche, R. A. (2008). Efecto del nivel de azúcar en la calidad de la efervescencia en sidra espumosa mediante análisis de imágenes. Ciencia y Tecnología Alimentaria, 6(1), 33-40. doi: 10.1080/11358120809487625

Steensels, J., & Verstrepen, K. J. (2014). Taming wild yeast: potential of conventional and nonconventional yeasts in industrial fermentations. Annual Review of Microbiology, 68(1), 61-80. doi: 10.1146/annurev-micro-091213-113025

Suárez-Valles, B., Pando-Bedriñana, R., Lastra-Queipo, A., & Mangas-Alonso, J. (2008). Screening of cider yeasts for sparkling cider production. Food Microbiology , 25(5), 690-697. doi: 10.1016/j.fm.2008.03.004

Ubeda, J., Briones, A. I., Izquierdo, P., & Palop, L. I. (1995). Predominant Saccharomyces cerevisiae strains in the fermentation of Airén grape musts with SO2. LWT- Food Science and Technology, 28(6), 584-588. doi: 10.1016/0023-6438(95)90005-5

Varela, C., Pizarro, F., & Agosin, E. (2004). Biomass content governs fermentation rate in nitrogen-deficient wine musts. Applied and environmental microbiology, 70(6), 3392-3400. doi: 10.1128/AEM.70.6.3392-3400.2004

Figures:

Figure 1. Evolution of the must density of 14 apple varieties.
Figure 2. Pressure generated by ten strains of native yeasts and commercial control K1-V1116 inside bottles. zMeans with the same letter do not differ statistically (Tukey, P ≤ 0.05).
Figure 3. Evolution of the pressure in the bottle as a function of the yeast used for the second fermentation of base cider. Means of six observations ± standard error.

Tables:

Table 1. Initial must characteristics of different apple varieties.
Apple variety Yield (L·kg-1 of apple) Sugars (°Brix) Density (g·mL-1) pH
429a 0.45 12.2 1.049 3.27
Rayada 0.43 11.4 1.043 3.21
Red Delicious 0.44 11.6 1.043 3.64
428 0.45 12.8 1.047 4.37
424 0.33 11.2 1.044 3.51
Malus x Micromalus 0.26 15.0 1.058 2.97
467 0.30 12.0 1.043 3.32
Joya 0.31 12.0 1.044 4.10
429b 0.29 12.0 1.047 3.31
Golden Delicious 0.30 15.4 1.062 3.36
Agua Nueva 0.40 17.0 1.066 3.32
436 0.31 14.2 1.054 4.45
Royal Gala 0.29 17.0 1.069 3.26
Rosada 0.36 14.4 1.060 3.46
Table 2. Phenotypic characterization for the selection of cider fermenting yeasts.
Apple variety Strain Positive aspects β-glucosidase Killer effect Flocculation Fermentation rate Tolerance to ethanol and SO2 Fermentation stage
- k1 5 + + Medium Medium + -
Malus x Micromalus MM7 5 + + Medium Medium + Final
Royal Gala RG6 5 + + Medium Fast + Final
436 436.4 5 + + Medium Fast + Intermediate
Red Delicious RD4 4 + + Medium Medium - Intermediate
428 428.5 4 + + Medium Medium - Intermediate
Agua Nueva AN7 4 + - High Fast + Final
Rayada RY3 4 + - Medium Fast + Intermediate
Royal Gala RG4 4 + - Medium Fast + Intermediate
428 428.6 4 + - Medium Medium + Final
429a 429a.9 4 + - Medium Fast + Final
436 436.5 4 - + Medium Medium + Intermediate
467 461.1 4 + - Medium Fast + Intermediate
467 467.2 3 + + Slight Medium - Intermediate
467 467.4 3 + + Slight Medium - Intermediate
467 467.5 3 + + Slight Medium - Intermediate
Red Delicious RD3 3 + + Slight Fast - Intermediate
428 428.3 3 + + Slight Medium - Intermediate
Red Delicious RD2 3 + - Medium Fast - Intermediate
Agua Nueva AN5 3 + - Medium Medium - Intermediate
Agua Nueva AN10 3 + - High Fast - Final
Agua Nueva AN8 3 + - High Fast - Final
Joya JY4 3 + - Medium Slow + Intermediate
Royal Gala RG7 3 + - Medium Fast - Final
Royal Gala RG8 3 + - Medium Fast - Final
424 424.4 3 + - Medium Fast - Intermediate
428 428.4 3 + - Medium Medium - Intermediate
428 428.8 3 + - Medium Fast - Final
429a 429.10 3 + - Medium Fast - Final
436 436.3 3 + - High Fast - Intermediate
436 436.9 3 + - Medium Medium - Final
436 436.10 3 + - Medium Medium - Final
Rayada RY5 3 - + Slight Medium + Intermediate
Rayada RY9 3 - + Slight Fast + Final
Rayada RY10 3 - + Slight Medium + Final
Royal Gala RG10 2 + - Slight Fast - Final
436 436.2 2 + - Slight Fast - Intermediate
Royal Gala RG3 2 - + Slight Slow - Intermediate
424 424.5 2 + + Slight Slow - Intermediate
428 428.2 2 + + Slight Slow - Intermediate
Joya JY1 2 + + Slight Slow - Intermediate
428 428.1 2 + - Medium Slow - Intermediate
436 436.1 2 + - Medium Slow - Intermediate
436 436.2 2 + - Medium Slow - Intermediate
436 436.7 2 + - Medium Slow - Final
Golden Delicious GD10 1 + - Slight Slow NE1 Final
Red Delicious RD7 1 + - Slight Slow NE Final
Agua Nueva AN1 1 + - Slight Slow NE Intermediate
Agua Nueva AN2 1 + - Slight Slow NE Intermediate
Agua Nueva AN3 1 + - Slight Slow NE Intermediate
Agua Nueva AN4 1 + - Slight Slow NE Intermediate
Agua Nueva AN6 1 + - Slight Slow NE Final
Joya JY6 1 + - Slight Slow NE Final
Joya JY8 1 + - Slight Slow NE Final
Malus x Micromalus MM4 1 + - Slight Slow NE Intermediate
Malus x Micromalus MM8 1 + - Slight Slow NE Final
Rayada RY1 1 + - Slight Slow NE Intermediate
424 424.3 1 + - Slight Slow NE Intermediate
424 424.7 1 + - Slight Slow NE Final
424 424.9 1 + - Slight Slow NE Final
428 428.7 1 + - Slight Slow NE Final
436 436.6 1 + - Slight Slow NE Final
467 467.3 1 + - Slight Slow NE Intermediate
467 467.6 1 + - Slight Slow NE Final
467 467.7 1 + - Slight Slow NE Final
467 467.8 1 + - Slight Slow NE Final
Strains are ordered from highest to lowest number of characteristics presented considered to be positive. The symbols indicate presence (+) or absence (-) of the aspect evaluated in each strain. 1NE = phenotype not evaluated due to lack of other desirable traits.
Table 3. Physical and chemical characteristics of sparkling ciders as a function of the yeast used in the second fermentation.
Treatment1 ABV RS (g·L-1) TTA (g·L-1) pH VA (g·L-1) SO2 (mg·L-1)
MM7-K1-V1116 8.57 ± 0.05 bz 1.65 ± 0.01 c 4.28 ± 0.03 a 3.66 ± 0.01 a 0.05 ± 0.03 b 226.13 ± 9.4 a
MM7-MM7 8.59 ± 0.05 b 1.96 ± 0.03 a 4.05 ± 0.03 c 3.64 ± 0.03 ab 0.07 ± 0.03 b 221.87 ± 0.9 a
MM7-436.4 8.13 ± 0.08 c 1.78 ± 0.01 b 4.21 ± 0.03 b 3.61 ± 0.02 b 0.04 ± 0.03 b 202.99 ± 13 a
MM7-RY5 8.89 ± 0.05 a 1.80 ± 0.03 b 4.21 ± 0.03 b 3.61 ± 0.01 ab 0.48 ± 0.03 a 205.3 ± 12 a
1Yeast strain used for the first fermentation + strain used for the second fermentation; ABV = alcohol by volume; RS: residual sugars; TTA: total titratable acidity; VA = volatile acidity. zMeans with the same letter within each column do not differ statistically (Tukey, P ≤ 0.05).
Table 4. Rank sum of the Friedman test to sensorially evaluate the quality of sparkling ciders made with four yeast strains.
Trait evaluated K1-V1116 436.4 MM7 RY5 F P
Crown height 22.51 34.5 24.5 18.5 9.58 0.0224
Crown reduction time 40.0 30.0 20.0 10.0 30.00 < 0.0001
Number of trains 38.5 10.0 31.5 20.0 29.35 < 0.0001
Bubble diameter 37.5 19.0 32.5 11.0 26.94 < 0.0001
Effervescence speed 20.0 34.0 36.0 10.0 27.12 < 0.0001
Visual 33.5 18.0 35.5 13.0 22.76 < 0.0001
Olfactory 40.0 30.0 20.0 10.0 30.00 < 0.0001
Taste 29.0 21.0 10.0 40.0 28.92 < 0.0001
1The treatment averages come from ten replicates (judges).
© Derechos reservados Universidad Autónoma Chapingo 2024 | Protección de Datos Personales