Introduction
The tomato (Solanum lycopersicum L.) is considered the most important horticultural export species, as well as being the most cultivated and with the highest consumption per capita. The main tomato-producing countries are China, India and the United States. Mexico ranks tenth with a planted area of 50,595.56 ha and a production of 3,098,329.41 t (Servicio de Información Agroalimentaria y Pesquera [SIAP], 2017).
The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis (Cmm) causes bacterial "wilt" and "canker," which are the most important diseases in tomato (EFSA Panel on Plant Health [PLH], 2014; Gartemann et al., 2003). On the other hand, Xanthomonas vesicatoria (Xv) is a Gram-negative bacterium that constitutes a complex of species associated with "bacterial spot" disease. Both pathogens are transmitted by seed and cause economic losses throughout the world (Jones, Jones, Stall, & Zitter, 1991; Jones, Lacy, Bouzar, Stall, & Schaad 2004).
Management strategies in tomato production systems for the aforementioned pathogens are not completely effective, so there is a growing demand for the development of new approaches with the least possible environmental impact. In this context, the study of microorganisms as biocontrol agents of plant diseases, biofertilizers and phytostimulators is increasing, in an effort to reduce the use of chemical pesticides in agriculture (Raaijmakers, Paulitz, Steinberg, Alabouvette, & Moënne- Loccoz, 2009).
Bacterization is the process of inoculating seeds, roots or other organs of the plant with bacteria to promote their growth (Kloepper, Lifshitz, & Schroth, 1988). Bio-priming is a technique that consists of hydrating, incorporating or coating the seed with microorganisms; this technique favors microbial activity with an ecological approach and is an important alternative to the use of pesticides for the management of soil diseases and those transmitted by seeds (Raj, Shetty, & Shetty, 2004; Rao, Kulkarni, Lingaraju, & Nadaf, 2009).
Several species of Pseudomonas possess genetic characteristics that are attractive for their exploration as microbial inoculants in agriculture (Meléndez-Monroy, Aranda-Ocampo, Carrillo-Castañeda, Hernández-Morales, & Soto-Rojas, 2016). In particular, fluorescent Pseudomonas populations have been considered excellent candidates for use as biological control agents (Höfte & Altier, 2010; Mercado-Blanco, Alós, Rey, & Prieto, 2016) and growth promoters in various agricultural production systems (Ahmadzadeh & Sharifi, 2009; Weller, 2007). Within the genetic populations of fluorescent Pseudomonas, strains can be isolated to be integrated as microbial inoculants capable of inhibiting the development of other microorganisms and of promoting beneficial effects, both in tomato seed germination and seedling growth. Therefore, the aim of this study was to identify Pseudomonas fluorescens strains of different ecological origin, as well as evaluate their antagonism against Cmm and Xv and their effect as growth promoters in tomato seed germination and seedling vigor.
Materials and methods
Isolation of fluorescent Pseudomonas
A collection of 356 fluorescent P. strains isolated from different ecological origins was used: 272 from the rhizosphere of roselle (Hibiscus sabdariffa L.) var. Criolla, 74 from the rhizosphere of tomato var. Cid and 10 from the sclerotium mycosphere of the maize (Zea mays L.) pathogen Claviceps gigantea. The fluorescent P. from the rhizosphere were isolated from 1 g of root with rhizospheric soil in 10 mL of sterile distilled water, which was kept under stirring for 10 min; from here serial dilutions were made (from 10-1 to 10-4) and 100 μL of the suspension was inoculated in Petri dishes with King’s B medium (King, Ward, & Raney, 1954) and incubated at 28 ± 2 °C for 72 h. For the isolation of the bacterial strains of the mycosphere, the previous procedure was used from 1 g of C. gigantean sclerotia. Fluorescent P. populations were verified by the fluorescence emission of the colonies under UV light (268 nm). The colonies in pure culture were preserved in nutrient broth and 40 % glycerol at -80 °C.
In vitro selection of antagonistic fluorescent Pseudomonas
The inhibitory effect of fluorescent P. against Cmm and Xv was determined in triplicate by in vitro dual confrontation tests in King’s B culture medium in Petri dishes (12 x 12 cm). The dishes were divided into 25 equal quadrants and each pathogen was inoculated individually with 500 μL of a suspension in sterile distilled water with a density of 3 x 108 colony forming units (CFU) per mL. Subsequently, each fluorescent strain was inoculated in the center of each quadrant with 3 µL of a suspension with 3 x 108 CFU·mL-1. The dishes were incubated at 28 ± 2 °C for 72 h; as a control, dishes inoculated only with the bacterial pathogens were established. The in vitro antagonism was determined by the formation of inhibition halos at the inoculation site and the width of the halo was measured with a scale ruler (0-30 cm, with a 1:100 scale).
Inoculation of fluorescent Pseudomonas in tomato seed
Twenty fluorescent strains exhibiting in vitro antagonism with an inhibition halo ≥ 5 mm against Cmm and Xv were selected. Fluorescent P. (n = 20) were inoculated by the Bio-priming technique in saladette tomato var. Río Grande seeds. Before inoculation, the seeds were hydrated using the method described by Artola, Carrillo-Castañeda, and García-de los Santos (2003): lots of 33 seeds were individually placed in a closed mesh with gauze within a bottle with 1 L of distilled water in aeration for 24 h by means of a fish tank pump. Afterwards, the seeds were uniformly distributed in plastic Petri dishes (60 mm diameter) and the water was removed from the surface by aeration with two fans for 3 h under laboratory conditions.
The fluorescent P. were inoculated in triplicate for each strain by immersing the seed for 2 h in 0.4 mL of a bacterial suspension at a cell density of 3 x 108 CFU·mL-1 (0.9 absorbance in a Coleman Junior® II 620 spectrophotometer at 660 NM). Each treatment was placed in Petri dishes with sterile filter paper, 3.5 mL of distilled water were added to each dish and then they were placed in a germination chamber at 28 ± 2 °C for 12 days (International Seed Testing Association [ISTA], 2009). The effect of the inoculating the bacteria was compared with seeds treated only with distilled water, for which daily counts of germinated seeds with radicles > 1 mm were made. The results were expressed as a germination percentage at 12 days of each inoculated fluorescent P. strain and the time (h) in which 50 % of the seeds germinated (T50) was determined according to the equation described by Salehzade, Shishvan, Ghiyasi, Forouzin, and Siyahjani (2009).
Where N is the final number of germination, nj and ni are the cumulative number of seeds germinated by adjacent counts at times when ni < N/2 < nj, ti the number of days corresponding to ni and tj the number of days corresponding to nj.
With the germination data, an analysis of variance was performed using the Statistical Analysis System package (SAS, 2002). The differences among the means of the treatments were estimated using Dunnett’s test to compare each treatment with the control (Narbona-Fernández, Ortiz-Ballesteros, & Arista-Palmero, 2003).
Effect of fluorescent Pseudomonas on tomato seedling vigor
Twenty germinated seeds for each replication of the previous experiment were randomly selected and transplanted into plastic trays with peat moss (PRO-MOSS TBK, made of select long-fibered blond Sphagnum peat moss) sterilized at 121 °C for 1.5 h. The trays were kept in a greenhouse for 45 days. After this time, 10 seedlings were taken per replication (30 seedlings per treatment), and the roots were washed with running water and left at room temperature for 72 h; subsequently, they were placed in an oven at 42 °C for 1 h and then kept at 60 °C for 24 h. At the end, an ESA 120A analytical balance was used to obtain the dry biomass weight of root and stem with foliage. For the analysis of the results, the same statistical procedure applied to germination was used.
Metabolite production by antagonistic fluorescent Pseudomonas
The 20 antagonistic strains were characterized by their production of 3-indole acetic acid (IAA) using the modified colorimetric method described by Sarwar and Kremer (1995), for which bacterial mass was inoculated into the well of the microplate and incubated at 28 ± 2 °C for 72 h, after which Salkowski reagent was directly added. The pink color shift in the inoculated substrate determined the production of IAA (+), and a more intense color was considered to represent a greater production of IAA (++). On the other hand, the production of siderophores (SID) was determined using the universal CAS agar protocol described by Schwyn and Neilands (1987); the formation of a yellow halo at the inoculation site determined the production of SID (+) by the bacterial strain.
Amplification of the 16S rDNA gene, sequencing and identification of fluorescent Pseudomonas
A Bio-PCR (biological and enzymatic polymerase chain reaction) was performed for the amplification of the 16S rRNA gene with the universal primers for Eubacteria FD1 (5’ AGAGTTTGATCCTGGCTCAG 3’) and RD1 (5’ AAGGAGGTGATCCAGCC 3’) that amplify a fragment of approximately 1,500 to 1,600 bp (Rodrigues, Silva-Stenico, Gomes, Lopes, & Tsai, 2003). An aqueous bacterial suspension was prepared in 100 μL of water for PCR (Promega Nuclease-Free water). The reaction was performed in a final volume of 25 µL containing 1 μL of the primers, at a concentration of 10 μM, buffer for PCR (at a concentration of 1X), MgCl2 at 1.5 mM, dNTP's at 200 μM, 2U of taq polymerase (Promega) and 2 μL of the bacterial suspension (DNA). The PCR conditions consisted of an initial denaturation cycle of 95 °C for 3 min, followed by 35 cycles at 94 °C for 1 min, 55 °C for 30 s, 72 °C for 2 min and a final extension of 72 °C for 7 min. Additionally, a 1 Kb molecular marker (Promega) was used. The reactions were carried out in a Techne® Prime thermal cycler.
The PCR products were analyzed by electrophoresis in 1 % agarose gel at 95 V for 45 min in 1X TBE buffer. The gel was stained with ethidium bromide and visualized in an imaging system (Infinity 5T-5). The PCR product was purified with the Wizard protocol (Tereba, 1999), and then sequenced, together with the FD1 primer, in the Unidad de Biología Molecular of the Instituto de Fisiología Celular of the Universidad Nacional Autónoma de México and compared with the GenBank database of the National Center for Biotechnology Information (NCBI) using the Basic Local Alignment Search Tool (BLAST).
Results and discussion
In vitro antagonism of Cmm and Xv by fluorescent Pseudomonas
The in vitro antagonism results indicated that 20 of the 356 evaluated fluorescent P. strains produced an inhibition halo ≥ 5 mm; of these, 100 % showed antagonism against Xv and 45 % (nine strains) expressed antagonism towards Cmm (Table 1). The results also indicated that among the different fluorescent P. isolates there are strains that differ in the range of metabolites produced that directly affect the in vitro sensitivity for one or both phytopathogenic bacteria, which highlights the genetic and metabolic diversity that can be found among these bacterial populations (Gross & Loper, 2009; Loper et al., 2012). This diversity is mediated by the ability to synthesize compounds with biological activity for biocontrol, such as hydrocyanic acid with nematicidal activity (Siddiqui, Shahid, Hussain, & Khan, 2006), siderophores such as pseudobactin and ferrioxiamine B (Saranraj, Sivasakthivelan, & Siva-Sakthi, 2013) and antibiotics such as phenazine-1-carboxylic acid, 2,4-diacetyl phloroglucinol, oomycin, pyrrolnitrin, kanosamine, pyoluteorin, zwittermycin-A and pantocin (Dilantha-Fernando, Nakkeeran, & Zhang, 2005). Therefore, the use of these microorganisms can be a relevant and safe alternative.
Table 1.
| Strain |
|
Metabolite production | Seed | Vigor | |||
|---|---|---|---|---|---|---|---|
|
|
|
SID | IAA | Germination (%) | T
|
Root dry biomass (g) | |
| Ccl | + | + | ++ | 91.9 | 37*** | 0.12297 | |
| Ecl | + | ++ | 91.9 | 37*** | 0.17073*** | ||
| 64JaF | + | + | 91.9 | 38*** | 0.12500 | ||
| 66JaF | + | + | 88.8 | 33*** | 0.13313*** | ||
| 71JaF | + | + | 91.9 | 36*** | 0.15113*** | ||
| 79JaF | + | ++ | 95.9 | 38*** | 0.12170 | ||
| 85JaF | + | - | 88.8 | 36*** | 0.14960*** | ||
| 94JaF | + | + | 87.8 | 39*** | 0.16757*** | ||
| 95JaF | + | + | 88.8 | 46 | 0.13600*** | ||
| 103JaF | + | ++ | 84.8 | 36*** | 0.14007*** | ||
| 104.HJaF | + | ++ | 91.9 | 39*** | 0.12570 | ||
| 107JaF | + | - | 80.8 | 35*** | 0.12497 | ||
| 114JaF | + | - | 92.9 | 36*** | 0.13923*** | ||
| 122JaF | + | - | 86.8 | 38*** | 0.13507*** | ||
| 123JaF | + | ++ | 93.9 | 38*** | 0.15267*** | ||
| 134JaF | + | + | 88.8 | 37*** | 0.13697*** | ||
| 138JaF | + | - | 84.8 | 37*** | 0.15447*** | ||
| 165JaF | + | - | 87.7 | 36*** | 0.14307*** | ||
| 177JaF | + | ++ | 93.9 | 39*** | 0.13733*** | ||
| 14.1JiF | + | - | 94.9 | 32*** | 0.14737*** | ||
| Control | 83.8 | 70 | 0.09603 | ||||
Effect of fluorescent Pseudomonas on tomato seed germination and seedling vigor
The results of the effect on germination of inoculating the tomato seeds with the fluorescent P. strains did not show a normal distribution; therefore, an angular transformation of the data was made, which consisted in obtaining the arcsine of the square root of the values obtained (McDonald, 2014), and subsequently an analysis of variance (P ≤ 0.05) was performed. The results showed no significant (P ≤ 0.05) statistical differences in the germination percentage of the seeds inoculated with the 20 fluorescent P. strains; however, 14 strains (75 %) increased the germination rate in a range of 31 to 38 h with respect to the control (Table 1), a benefit that has been demonstrated in other studies (Raj et al., 2004; Weller, 2007).
In relation to the expression of seedling vigor, 15 of the 20 evaluated strains (75 %) increased the root dry biomass in ranges from 138 to 177.7 % with respect to the control, and of these, four (26.6 %) showed a relationship with SID production and higher IAA production (++) (Table 1). In this regard, of the metabolic characterization of the 20 inoculated fluorescent P. strains, 100 % produced SID and 13 strains (65 %) IAA, of which 7 (35 %) had the highest production of this acid (Table 1).
Various fluorescent P. populations are considered among the most suitable bacteria to stimulate and promote plant growth, which is related to the production of phytohormones and SID (Saha, Saha, Donofrio, & Bestervelt, 2013). SID production is an important metabolic expression in colonization, competition for nutrients and biocontrol of pathogens (Ali-Saber, Abdelhafez, Hassan, & Ramadan, 2015). Likewise, IAA biosynthesis by fluorescent P. stands out as a root growth promoter by stimulating cell division and elongation, thereby increasing the capacity for nutrient acquisition; in addition, it induces the activity of ethylene and the enzyme ACC deaminase, which improves plant nutrition and its resistance to stress factors (Glick, 2014; Grobelak, Napora, & Kacprzak, 2015).
The increased dry biomass weight of the tomato seedling root shows the beneficial role of the fluorescent P. used, which could be constituted as a valid scheme to select potentially efficient bacteria as growth promoters. The results of this research coincide with other studies that have shown that the growth-promoting bacteria of plants base their ability on the production of IAA and SID (Ali-Saber et al., 2015; Magnucka & Pietr, 2015).
Identification of antagonists
With the amplification of the 16S rRNA gene from the 20 bacterial strains by means of primers FD1 and RD1, a fragment of approximately 1,500 bp was obtained. The sequencing and alignment of these strains in the NCBI identified 13 (65 %) as Pseudomonas sp., 5 (25 %) as P. putida and 2 (10 %) as P. fluorescens (Table 2).
Table 2.
| Strain | Ecological origin | Identification | NCBI access no. |
|---|---|---|---|
| Ccl |
|
KP050500.1 | |
| Ecl |
|
DQ095904.1 | |
| 64JaF |
|
GU990089.2 | |
| 66JaF |
|
GU990089.2 | |
| 71JaF |
|
GU990089.2 | |
| 79JaF |
|
KF030906.1 | |
| 85JaF |
|
GU990089.2 | |
| 94JaF |
|
GU990089.2 | |
| 95JaF |
|
KF030909.1 | |
|
|
AM745260.1 | ||
| 104.HJaF |
|
KF030906.1 | |
| 107JaF |
|
AB269776.1 | |
| 114JaF |
|
KJ534476.1 | |
| 122JaF |
|
GU990089.2 | |
| 123JaF |
|
GU990089.2 | |
| 134JaF |
|
GU990089.2 | |
| 138JaF |
|
GU990089.2 | |
| 165JaF |
|
GU990089.2 | |
| 177JaF |
|
KF030909.1 | |
| 14.1JiF |
|
AM745260.1 |
In other studies, inoculating the tomato seed and root with fluorescent P. showed its efficiency in the promotion of plant growth and control of Cmm in the greenhouse (Amkraz, Boudyach, Boubaker, Bouizgarne, & Ben-Aoumar, 2010 Umesha, 2006), as well as other fungal pathogens in tomato (Pastor, Carlier, Andrés, Rosas, & Rovera, 2012; Srivastava, Khalid, Singh, & Sharma, 2010). In this work, 50 % of the strains identified as P. fluorescens and 60 % as P. putida inhibited the in vitro growth of Cmm and Xv; therefore, they can be considered as bacterial strains with high potential for biocontrol. Some researchers have highlighted the high efficiency of P. putida and P. fluorescens as growth promoters and biocontrol agents in the protection of the tomato crop. Byrne et al. (2005) and McSpadden-Gardener (2007) indicate that P. putida was effective under field conditions in reducing the severity of foliar infections caused by Xv, while Kavitha and Umesha (2007) mention that P. fluorescens inoculated in the tomato seed improved germination and significantly decreased the incidence of Xv under field conditions; in addition, Vanitah, Niranjana, Mortensen, and Umesha (2009) report its efficiency against other important bacterial pathogens in this crop.
The bacteria P. putida (strain 177Jaf) and P. fluorescens (strain Ecl), inoculated in tomato seeds, could be considered as having high potential for use as growth promoters and biocontrol agents in tomato cultivation, since both strains showed the highest significant increase in seed germination rate (T50), root biomass (root dry weight) and degree of in vitro antagonism against Cmm and Xv (Tables 1 and 2).
Conclusions
Among the studied strains of fluorescent Pseudomonas of different ecological origin, some showed a high degree of antagonism in vitro against Clavibacter michiganensis subsp. michiganensis and Xanthomonas vesicatoria. It is important to emphasize that Gram-negative bacteria are more sensitive to the metabolites involved in antagonism than Gram-positive bacteria.
Inoculating tomato seeds with the selected microorganisms increases the germination rate and vigor. Additionally, the strains of Pseudomonas putida (177Jaf) and Pseudomonas fluorescens (Ecl) inhibit both bacterial pathogens and act efficiently as growth promoters in the tomato seed, so this type of microorganism can be used to increase agricultural productivity
