Highlights:
-
•
The presence of polyphenols and polysaccharides impede the extraction of total RNA from pecan nut.
-
•
RNA extraction protocols based on TRI Reagent®, CTAB buffer and a commercial kit were evaluated.
-
•
The quality of total RNA varied according to the efficiency of the method used.
-
•
The TRI Reagent® provided high but contaminated concentrations of total RNA.
-
•
The CTAB buffer provided high concentrations and quality of total RNA from pecan embryo tissue.
Introduction
Pecan nut (Carya illinoinensis [Wangenh.] K. Koch), due to its extensive climatic adaptation and high profitability, is a widely cultivated species in northern Mexico (Cruz-Álvarez et al., 2020; Orona Castillo, Sangerman-Jarquín, Fortis Hernández, Vázquez Vázquez, & Gallegos Robles, 2013). Regions with populations of Carya genus have extreme conditions with high temperatures and low precipitation, especially in autumn, a situation that, combined with high humidity, favors nut viviparity in native trees growing in spontaneous populations (Sparks, 2005), and in commercial orchards (Rodríguez-González et al., 2022). The commercial importance of C. illinoinensis has led to the study of viviparity and several investigations report the control of this phenomenon (Barrera, Guillen, Tamargo, Rangel, & Murrieta, 2017; García-Moreno, Báez-Sañudo, Mercado-Ruiz, García-Robles, & Núñez-Moreno, 2020; Wood, 2015); however, the molecular mechanism of gene expression related to viviparity is scarcely documented, so it is important to study them. Gene expression analyses have been widely used in biological research and have contributed significant advances in understanding the molecular mechanisms of complex physiological problems such as premature seed germination, even when the seed is still attached to the plant.
Advances in molecular biology provide the necessary tools for the study of plants at the molecular level. Some techniques are useful for germplasm characterization, genome-wide identification and gene expression contributing to a better understanding of genetics and transcriptional regulation (Liu et al., 2012). However, these studies would not be possible without the isolation of quality total RNA (ribonucleic acid), because it is the first step for the development of other molecular techniques and secures the results of downstream procedures (after the RNA extraction stage) (Sandoval-Pineda, Ochoa-Corona, & Torres-Rojas, 2017).
Obtaining quality RNA from woody and perennial plant tissues is challenging due to high concentrations of polysaccharides, polyphenols and other secondary metabolite (Gambino, Perrone, & Gribaudo, 2008). In the particular case of pecan embryonic tissue, obtaining low-quality RNA is frequent due to the presence of total phenolic compounds, flavonoids and proanthocyanidins or condensed tannins that can be easily oxidized, in addition to fatty acids such as tocopherols and phytosterols (Flores-Cordova, Muñoz-Márquez, Ojeda-Barrios, Soto-Parra, & Preciado-Rangel, 2017; Reyes, 2016). As a result of interference from these secondary compounds, standard extraction protocols require modifications for the isolation of high-quality nucleic acids with good yields. To date, the use of some protocols for RNA and DNA extraction from root, stem, leaf and fruit from the Carya genus has been reported (Mattison et al., 2017; Qiu et al., 2016; Zheng et al., 2010). These protocols use phenol, trizole, sodium dodecyl sulfate (SDS), lithium chloride and hexadecyltrimethylammonium bromide (CTAB). Commercial extraction kits have also been used due to their high sensitivity, specificity and reproducibility, such as the RNeasy mini kit (QIAGEN, Germantown, MD, USA) and the mirVana miRNA isolation kit (Ambion/Life Technologies, Carlsbad, CA, USA) for RNA extraction from Carya cathayensis Sarg. flower buds (Tongqiang, Qixiang, Yuanyuan, Wang, & Huang, 2020; Wang, Huang, Sun, & Zheng, 2015); however, the quality and yield of total RNA varies between methodologies and the plant tissue used. This is because several secondary compounds co-precipitate with RNA exposing it to degradation by RNAases (George, 2018). In the present study, the extraction efficiency of high-quality total RNA extraction for use in downstream gene expression assays was evaluated from the embryonic tissue of pecan nuts from C. illinoinensis from a spontaneous population.
Materials and Methods
Plant material and growing conditions
Pecan nut samples were collected from adult criollo pecan trees belonging to a spontaneous population over 50 years old. The criteria for tree selection was a height of approximately 15 m and a circumference of 90 cm (measured at 60 cm from the ground). Nuts were collected from 10 trees during the ripening stage (September) in 2020, with two characteristics: normal mature nut and mature nut with germinated embryo. The nuts were wrapped in aluminum foil for analysis, immediately put on ice and then stored at -20 °C until processing.
The criollo pecan tree population is located in the municipality of Nazas, Durango, Mexico, with geographical coordinates 25° 13´ 34´´ LN and 104° 06´ 39´´ LW and elevation of 1 250 m. The climate is dry (BWhw(w)(e)) with summer rainfall, annual precipitation of 330.8 mm and mean annual evaporation of 2 259.3 mm. Mean annual temperature of 20.2 °C (Servicio Meteorológico Nacional [SMN], 2020).
Total RNA extraction
The RNA extraction process was carried out in the Microbial Ecology Laboratory and Molecular Biology Laboratory of the Faculty of Biological Sciences of the Universidad Juárez del Estado de Durango.
Protocols were performed in a decontaminated and nuclease-free area to avoid RNA degradation. Extraction buffers and solutions were sterilized using 0.22 µm filters. The supplies were heat and pressure sterilized in an autoclave. The electrophoresis chambers and photodocumenter were treated with DEPC (diethylpyrocarbonate) water.
For the total RNA extraction process, 100 mg of pecan embryo tissue previously homogenized by maceration with liquid nitrogen was used. Eight protocols that have been documented for their effectiveness for RNA extraction from plant samples with high lipid, phenol and polysaccharide contents were evaluated. These protocols are described as follows.
TRIzol 1 (TRI Reagent®; Sigma-Aldrich, St. Louis, MO, USA): Total RNA was extracted according to the protocol reported by Li, Zhang, Liao, and Liu (2014). The extraction solutions used were TRI Reagent®, β- mercaptoethanol, potassium acetate 2.5 M (pH 5.2) and chloroform:isoamyl alcohol (24:1). Total RNA was precipitated with isopropanol for 30 min at -20 °C, followed by two washes with 70 % ethanol. The pellet was dried at room temperature and rehydrated in DEPC water.
TRIzol 2 (TRI Reagent®; Sigma-Aldrich, St. Louis, MO, USA): Total RNA was extracted according to the protocol provided by the supplier. The extraction solution is a mixture of guanidine thiocyanate and phenol. Total RNA was precipitated with isopropanol for 10 min at room temperature, followed by washing with 70 % ethanol. The pellet was dried at room temperature and resuspended in DEPC water.
TRIzol 3 (TRI Reagent®; Sigma-Aldrich, St. Louis, MO, USA): Total RNA extraction was carried out using the procedure reported by Ortega-González et al. (2018). Total RNA was precipitated in a mixture of isopropanol and 3 M sodium acetate overnight at -20 °C, followed by two washes with 70 % ethanol, and again precipitated for 30 min at -20 °C. The pellet was dried at room temperature and dissolved in DEPC water.
Kit RNeasy® Power Plant® (QIAGEN, Germantown, MD, USA): Total RNA was extracted according to the manufacturer's instructions. The method uses BML (guanidine salts) solution as lysis buffer, β-mercaptoethanol and phenolic separation solution (PSS). RNA was purified by centrifugation on silica membrane columns; 50 μL of RNAase-free water was added for elution, incubated 1 min at room temperature and centrifuged 1 min at 14 000 rpm for subsequent storage.
CTAB 1: Total RNA was isolated using the protocol described by Rubio-Piña and Zapata-Pérez (2011). Extraction was carried out using extraction buffer 1 based on CTAB ionic detergent (CTAB 2 %, Tris-HCl 100 mM [pH 8], NaCl 1.4 M, EDTA 20 mM [pH 8], PVP 2 %) and β-mercaptoethanol (added just before use), followed by two more extractions with phenol:chloroform (1:1) and chloroform:isoamyl alcohol (24:1). Precipitation of total RNA was with LiCl (8 M) for 4 h at -20 °C, followed by a first wash with 96 % ethanol and a second wash with 70 % ethanol. The pellet was dried at room temperature and resuspended in DEPC water.
CTAB 2: Total RNA extraction was carried out using the protocol described by Rubio-Piña and Zapata-Pérez (2011) with modifications. Total RNA was collected with extraction buffer 1 CTAB (CTAB 2 %, Tris-HCl 100 mM [pH 8], NaCl 1.4 M, EDTA 20 mM [pH 8], PVP 2 %) and β-mercaptoethanol (added just before use). The variation from the previous protocol was to perform two more extractions with phenol:chloroform:isoamyl alcohol (25:24:1) and chloroform:isoamyl alcohol (24:1). RNA was precipitated in LiCl (8 M) for 4 h at -20 °C, followed by a first wash with 96 % ethanol and a second wash with 70 % ethanol. The pellet was dried at room temperature and dissolved in DEPC water.
CTAB 3: To obtain total RNA, the process reported by Salinas et al. (2019) was followed, modifying the volumes handled. 600 μL of CTAB-based extraction buffer 2 (CTAB 2 %, PVP 2 %, Tris-HCl 100 mM [pH 8], NaCl 2 M, EDTA 25 mM, espermidine 0.05 %) and 100 µL de β-mercaptoethanol were added just before use. The sample was incubated 10 min at 65 °C. Subsequently, 500 μL of chloroform:isoamyl alcohol (24:1) was added and vortex mixed. The sample was centrifuged at 10 000 rpm for 10 min at 4 °C. The supernatant (yellow color) was transferred to a new tube and reserved on ice. The precipitate was extracted a second time with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). The supernatants were combined, and the total RNA was precipitated in 10 M LiCl overnight at 4 °C. This was followed by washing with 75 % ethanol. The sample was centrifuged at 10 000 rpm for 20 min at 4 °C and the pellet was dried at room temperature and rehydrated in DEPC water.
CTAB 4: Total RNA was obtained based on the method described by Chang, Puryear, and Cairney (1993) with some modifications. The volumes used were smaller than those reported and the 65 °C incubation of the extraction buffer was omitted. For extraction, 600 µL of extraction buffer 2 (CTAB 2 %, PVP 2 %, 100 mM Tris-HCl [pH 8], 2 M NaCl, 25 mM EDTA, 0.05 % spermidine) and 100 µL of β-mercaptoethanol were added just before use. The volume was vortex mixed and 600 µL of chloroform:isoamyl alcohol (24:1) was added. The sample was centrifuged at 10 000 rpm for 10 min at 4 °C, followed by a second extraction with 600 µL phenol:chloroform:isoamyl alcohol (25:24:1), vortexed and centrifuged at 10 000 rpm for 10 min at 4 °C; in the original report they used chloroform:isoamyl alcohol (24:1). Total RNA was precipitated in 175 µL of 8 M LiCl (in the original report they used 10 M LiCl), overnight at 4 °C. The next day, the RNA was centrifuged 20 min at 10 000 rpm. The precipitate was dissolved in 500 µL of SSTE buffer (1 M NaCl, 0.5 % SDS and 10 mM Tris-HCl [pH 8]) and a new extraction was carried out with 500 µL phenol:chloroform:isoamyl alcohol (25:24:1); in the original report they used chloroform:isoamyl alcohol (24:1). Additionally, total RNA was washed with 800 µL of 70 % ethanol and precipitated for 2 h at -20 °C. The pellet was dried at room temperature and dissolved in DEPC water.
Evaluation of RNA integrity and quality
Total RNA extraction was evaluated for quantity, purity and integrity by spectrophotometry (NanoDrop 2000, UV/Vis, Thermo Scientific) and horizontal electrophoresis on 1 % agarose gels.
Total RNA concentration was measured by optical density at 260 nm and purity was confirmed by the ratio of absorbance indices at 260 and 280 nm (A260/280), and at 260 and 230 nm (A260/230) to evaluate the presence of proteins or phenolic compounds. An A260/230 ratio between 1.8 and 2.0 indicates good quality RNA while below 1.8 suggests contaminated RNA and <1.5 RNA highly contaminated with phenolic compounds, carbohydrates, EDTA and other contaminants with UV absorption at 230 nm. While the A260/280 ratio should be between 2.0 and 2.2 to consider optimal purity and >1.7 for acceptable purity. If the ratio is less than 1.7 it indicates contamination with proteins or other contaminants with UV absorption at 280 nm (Silveira de Campos et al., 2017).
RNA integrity was assessed by agarose-MOPS-formaldehyde gel electrophoresis at 50 V for 45 min, using MOPS 1X as electrophoresis buffer. Gel Red® (Biotium, Hayward, CA, USA) was used for RNA staining. Gels were visualized with ultraviolet light on a UVP® MultiDoc It Imaging System UVP® photodocumenter.
cDNA synthesis by RT-PCR
The quality of RNA extracted with each protocol was assessed by reverse transcription polymerase chain reaction (RT-PCR). All total RNA samples were treated with DNase I (RNAase-free) (Invitrogen, Waltham, MA, USA) according to the manufacturer's specifications and then retrotranscribed to first-strand cDNA by using an Oligo-(dT) primer and M-MLV RT Reverse Transcriptase (Promega, Fitchburg, WI, USA) following the supplier's instructions. The cDNA was amplified using Taq polymerase enzyme (Jena Bioscience, Dortmund, Germany) according to the manufacturer's specifications. Oligonucleotides from the constitutive actin gene of C. illinoinensis: F 5´CGATGCCCTGAGGTTCTATTC 3´ and R 5´GATCCTCCAATCCAGACACTATAC 3´ were used to amplify a 266 bp product. Those primers were designed via the IDT (Integrated DNA Technologies) online platform based on the whole genome sequence of C. illinoinensis cultivar 87MX3-2.11 (CM028997.1) (Platts et al., 2021), obtained through the GenBank of the Center for Biotechnology Information (NCBI). For a standard 25 µL RT-PCR reaction, 40 ng∙µL-1 of total RNA was used. The PCR amplification program included an initial denaturation of 2 min at 92 °C; subsequently, 35 cycles comprising the following steps: denaturation at 95 °C for 15 s, alignment 55 °C for 15 s and extension 72 °C for 1 min 30 s; and a final extension of 2 min at 72 °C. The amplified products were separated on a 2 % agarose gel, stained with Gel Red® (Biotium, Hayward, CA, USA), at 75 V for 45 min and visualized with ultraviolet light in a UVP® MultiDoc It Imaging System photodocumenter.
Statistical analysis
Differences between the absorbances and concentrations obtained, for each of the protocols, were determined with an ANOVA model with three replicates and a Tukey's mean test (P < 0.05). The SAS program version 9.4 was used for this purpose (SAS Institute, 2017).
Results
RNA extraction protocols are usually evaluated based on quantity, quality and integrity for RT-PCR, qPCR, cDNA library construction and gene expression analysis (Zhihui et al., 2015).
Regarding the extraction protocols based on TRI Reagent® reagent, the concentration of total RNA (Table 1) was higher with the TRIzol 3 method, both in mature and germinated pecans, with average values of 2 298.9 ng∙µL-1 and 1 456.6 ng∙µL-1, respectively. Furthermore, an average of 1 333.4 ng∙µL-1 in mature pecan and 537.6 ng∙µL-1 in germinated walnut was obtained with TRIzol 1 protocol. The average RNA yield obtained with TRIzol 2 was 240.2 ng∙µL-1 for mature nut and 359.4 ng∙µL-1 for germinated nut. In terms of quality, the samples presented a ratio A260/230 < 1.5 and A260/280 < 1.7 (Table 2), values below the acceptable purity range, indicating high contamination by proteins and phenolic compounds.
RNA extraction using RNeasy® Power Plant® Kit produced samples with average concentrations of 663.3 ng∙µL-1 for mature nut tissue and 60.1 ng∙µL-1 for germinated nut samples (Table 1). For mature pecan nut, acceptable purity values were obtained (A260/280 > 1.7) although with possible contamination with proteins and phenols (A260/230 < 1.5). For germinated pecan nut, absorbance values indicated highly contaminated RNA (A260/230 < 1.5 and A260/280 < 1.7) (Table 2).
The average concentration of total RNA with the CTAB 1 method and the use of phenol:chloroform (1:1) and chloroform:isoamyl alcohol (24:1) in the extraction process was 600 to 700 ng∙µL-1 with an acceptable quality range (A260/280 > 1.7), although with the presence of contaminating compounds (A260/230 < 1.5). In the case of the CTAB 2 protocol and the addition of phenol:chloroform:isoamyl alcohol (25:24:1) and chloroform:isoamyl alcohol (24:1), up to 739.4 ng∙µL-1 of total RNA from mature pecan nut and 372.9 ng∙µL-1 of total RNA from germinated pecan nut were obtained, with no differences in quality with reference to the CTAB 1 protocol. Moreover, with the CTAB 3 protocol, total RNA concentrations were similar to those obtained with CTAB 1 and CTAB 2 (400-600 ng∙µL-1) with acceptable absorbance values (A260/280 > 1.7) and presence of contaminants (A260/230 < 1.5).
Finally, the CTAB 4 protocol led to total RNA concentrations of 400 ng∙µL-1 and increased purity in both mature nut (A260/230 = 1.89 and A260/280 = 2.07) and germinated nut (A260/230 = 1.87 and A260/280 = 1.86), decreasing the presence of lipids and phenolic compounds compared to the seven protocols cited above. Therefore, the lower volume RNA extraction and the use of phenol:chloroform:isoamyl alcohol (25:24:1) represent an efficient alternative for RNA isolation from pecan embryonic tissues, since this protocol provides good quality total RNA for subsequent qPCR analysis.
Table 1.
| Protocol | Mature pecan nut (ng∙µL-1) | Germinated pecan nut (ng∙µL-1) |
|---|---|---|
| TRIzol 1 | 1 333.4 ab | 537.6 b |
| TRIzol 2 | 240.2 b | 359.4 b |
| Kit | 663.3 b | 60.1 c |
| TRIzol 3 | 2 298.9 a | 1 456.6 a |
| CTAB 1 | 685.2 b | 712.2 ab |
| CTAB 2 | 739.4 ab | 372.9 b |
| CTAB 3 | 611.7 b | 485.3 b |
| CTAB 4 | 421.6 b | 425.1 b |
Mean concentrations (n = 3) with the same letters in the same column are statistically equal according to Tukey's test (P > 0.05).
Table 2.
| Protocol | Mature pecan nut | Germinated pecan nut | ||
|---|---|---|---|---|
| A260/230 | A260/280 | A260/230 | A260/280 | |
| TRIzol 1 | 0.41 d | 1.66 b | 0.62 c | 1.13 b |
| TRIzol 2 | 0.48 d | 1.20 c | 0.41 d | 1.63 b |
| Kit | 1.30 b | 1.97 b | 0.32 d | 1.25 b |
| TRIzol 3 | 0.39 d | 1.06 c | 0.45 d | 1.07 b |
| CTAB 1 | 1.16 b | 1.87 b | 1.25 b | 1.80 a |
| CTAB 2 | 1.11 b | 1.79 b | 1.07 c | 1.77 a |
| CTAB 3 | 0.86 c | 1.70 b | 1.29 b | 1.84 a |
| CTAB 4 | 1.89 a | 2.07 a | 1.87 a | 1.86 a |
Mean concentrations (n = 3) with the same letters in the same column are statistically equal according to Tukey's test (P > 0.05).
Integrity and quality assessment of the total RNA
Regarding the integrity of total RNA, in most protocols two consecutive clear bands, characteristic of ribonucleic acid, were seen, confirming its purity. Integrity was null for TRIzol 1 and TRIzol 3 methods, indicating RNA degradation, but was preserved in the four CTAB-based protocols. The RNA samples obtained with the kit were also able to confirm their integrity, although with remnants of certain compounds that interfered with their quality (Figure 1).

RT-PCR and cDNA synthesis
A reference primer pair for detection of the C. illinoinensis actin gene was designed to evaluate the effectiveness of the RNA extraction protocols. Electrophoresis showed high specificity and proved the presence of this gene in pecan embryo tissue.
Extraction using protocols based on TRI Reagent® showed high RNA concentration; however, since it was contaminated with phenolic compounds and used in the RT-PCR reaction, it produced low yields in the amplified products for the two pecan nut conditions (Figure 2). For RNA obtained using the kit and CTAB 1, amplification was achieved only in germinated pecan. The negative amplification in mature pecan could have been due to the presence of inhibitors such as lysis buffer or some detergents that interfered with the efficiency of the RT-PCR reaction (Sandoval-Pineda et al., 2017). On the other hand, RNA obtained with CTAB 2, CTAB 3 and CTAB 4 protocols generated a clear band compared to the rest of the protocols; this indicates that RNA purity is closely related to amplification efficiency in the RT-PCR reaction. These results confirm that, although relatively low amounts of RNA were collected with the CTAB protocols, total RNA had good quality and can be used in downstream gene expression studies.

Discussion
A large number of protocols for the extraction of quality nucleic acids from plant tissues have been reported; however, the methods remain empirical, due to the variability in their composition (Sánchez-Coello et al., 2012).
The TRI Reagent® has been successfully used in the extraction of RNA from plant species, because as a single phase solution it solubilizes the biological material and denatures the proteins and, when combined with chloroform, allows phase separation, where the protein is extracted to the organic phase, the DNA remains at the interface and the RNA remains in the aqueous phase (Martínez-López, Lesher, & Jiménez-García, 2013; Ma & Li, 2022). In this study, protocols based on TRI Reagent® reagent showed the highest concentration yields, but with higher degree of contamination. It is possible that the low RNA quality obtained in these protocols is due to contamination by phenolic compounds and lipids characteristic of pecan nut. Some authors have reported that RNA from Hyptis suaveolens (L.) Poit., Prosopis juliflora (Sw.) DC. and ascomycetous fungi Xylaria sp., extracted using TRI Reagent® may have low quality due to the presence of mucilage, secondary metabolites, polysaccharides, phenols and carbohydrates (Michel-López et al., 2018; Ortega-González et al., 2018; Sandoval-Pineda et al., 2017). Some authors also mention that polyphenols are released and mixed with nucleic acids during the cell lysis process and, consequently, RNA quality and yield decrease (Ferriol-Marchena, Luis-Pantoja, Ruiz, Hernández-Rodríguez, & Pérez-Castro, 2015). The above due to the catecholase activity of polyphenols that allows them to couple to nucleic acids degrading them or causing them to precipitate with them. It has been reported that the use of concentrated sodium acetate (3 M) allows an effective precipitation of RNA by removing contaminating polysaccharides and protein (George, 2018); however, the results in this study differ, since, although high concentrations were obtained, viability and integrity of total RNA was not achieved, which could be due to the type of tissue and the species used for the extraction procedure.
For the commercial kit, the RNeasy® Power Plant® Kit system is recommended by the manufacturer for effective extraction of total RNA from various plant tissues with high phenol and polysaccharide contents. In this study, although it was possible to extract total RNA from pecan nut, the expected optimal purity was not achieved. According to Sánchez-Rodríguez and collaborators (2008), when extraction kits are used, contamination can occur due to the presence of residual sugars, since these are capable of establishing hydrophobic interactions with the matrix.
Protocols using CTAB as an essential part of the extraction buffer are conventional methods to isolate nucleic acids from plant tissues rich in polysaccharides and polyphenols. CTAB is commonly used in interaction with detergents such as SDS, denaturing organic solvents such as phenol and chloroform, and reducing agents such as β-mercaptoethanol (Gambino et al., 2008). In this study, the CTAB buffer-based protocols produced acceptable total RNA yields by increasing purity and decreasing the presence of contaminants. Specifically, the CTAB 4 protocol showed the best results in both concentration and quality for the two nut types, which was confirmed by RT-PCR amplification of the 266-bp actin gene fragment. The CTAB protocol as buffer in interaction with Tris-HCl, NaCl, EDTA, PVP, spermidine, β-mercaptoethanol and LiCl is an efficient process, since it includes a combination of extractions with chloroform:isoamyl alcohol (24:1) and phenol:chloroform:isoamyl alcohol (25:24:1); these reduce total RNA losses due to the formation of insoluble complexes at the interface, protein denaturation and correct separation of nucleic acids (Djami-Tchatchou & Straker, 2012; Thermo Fisher Scientific, 2021).
Similar studies have reported that the use of agents such as CTAB and LiCl increases RNA purity significantly for organisms with high contaminant content (Martínez et al., 2013; Sánchez et al., 2008). CTAB is able to form complexes with polysaccharides and polyphenols removing them from solution (Orek, 2018; Zhao et al., 2012), while LiCl allows a differential precipitation of RNA and other substances such as DNA, proteins and carbohydrates (Hernández-Guzmán & Guzmán-Barney, 2013). The use of SDS and EDTA in the extraction buffer has also been studied proving to be good inhibitors of RNAases (George, 2018), as they dissolve membranes and denature proteins allowing purification of nucleic acids (Rio, Ares, Hannon, & Nilsen, 2010). Furthermore, PVP and β-mercaptoethanol, compounds frequently used because they improve RNA yield and quality, help suppress oxidation, remove ribonucleases released during cell lysis, and deactivate proteins, allowing extraction of nucleic acids from plants (George, 2018; Michel-López et al., 2018; Mommaerts, Sanchez, Betsou, & Mathieson, 2015).
The interaction of these compounds led to high-quality total RNA from pecan nut embryo tissue, making CTAB 4 an effective protocol for future molecular studies in C. illinoinensis. The CTAB 4 protocol was designed based on other protocols and to be performed in a microextraction format, starting from a minimum amount of sample and using a much smaller volume of reagents. A microextraction is important because it produces a minimum amount of toxic waste and optimizes the use of resources.
Conclusions
The efficiency of eight protocols for the extraction of total RNA from was evaluated in this study, and significant differences were determined regarding quality and quantity, from the embryonic tissue of normal mature pecan nut and germinated embryo. With the protocols based on TRIzol reagent and the commercial kit, high concentrations of total RNA were obtained; however, the quality was deficient, which was corroborated by the null amplification of the actin control gene by RT-PCR. Protocols based on CTAB extraction buffer, established for RNA extraction, are useful in downstream applications. Specifically, the CTAB 4 protocol was the most efficient for the extraction of high-quality total RNA from pecan embryonic tissues, which guarantees obtaining samples for gene expression analysis in C. illinoinensis.
